5 RNA-Seq identyfikuje Fhl1 jako modyfikator genetyczny w kardiomiopatii ad 6

Odczytane profile głębokości zostały skonstruowane za pomocą wachlarzy Tophat. narzędzie i wartości zostały znormalizowane do sumowania wyrównanych odczytów i przesłane do przeglądarki UCSC (28) lub IGV (29). Pokazane głębokości zostały dostosowane po wizualizacji za pomocą UCSC Genome Browser. Profile ekspresji genów skonstruowano, oceniając odczyty na loci genów, stosując wartość Bayesa P do oceny istotności różnic ekspresji genów między próbkami (16, 30). Samtools (31) został użyty do generowania i przetwarzania binarnych plików wyrównania. Wykresy odczytów kierunkowych generowano przez przypisanie odczytów genów do pojemników w oparciu o pozycję odczytu w transkrypcie, w tym regionów położonych w górę i w dół. Analizę ontologii genów przeprowadzono za pomocą bazy danych Adnotation, Visualization i Integrated Discovery (DAVID), wersja 6.7 (32). Porównanie całego genomu próbek serca MHC403 / + i WT, w tym rozkłady odczytu w 5. Koniec i poziom ekspresji są dostępne w GEO (nr dostępu GSE52038). Uwzględnione dane obejmują gen (a), (b) opis, (c) chromosom, (d) współrzędną początku genomu, (e) współrzędną końca genomu, (f) nicią, (g) współrzędnymi początkowymi transkrypcji z adnotacjami, (h) 5. region wykorzystywany przez algorytm analizy początkowej, (i) wynik 5. RNA-Seq, (j) odczyt zliczeń znormalizowanych do x 106 odczytów całkowitej próbki dla wskazanej próbki, (k) znormalizowane odczyty zliczania dla wskazanej próbki w j , (l) liczba odczytywanych genów dla wskazanej próbki, (m) odczyt zliczeń genu dla wskazanej próbki, (n) zmiana krotności między 2 znormalizowanymi odczytanymi zliczeniami 2 próbek, jak wskazano, (o) Porównanie wartości Bayesian P pomiędzy 2 odczytaj wartości. Matematyczne formułowanie algorytmu analizy start-site. Dla dowolnego genomu G o całkowitej liczbie genów m, powiedzmy {x1, x2, x3. . . xm}, definiujemy tutaj typowy model genu i algorytm matematyczny. Załóżmy typowy gen x. {X1, x2, x3. . . xm} z genomu G ma n izoform, a każda izoforma ma unikalną 5. pozycja (rysunek 1B). Załóżmy, że całkowita liczba odczytów dla genu x wynosi xa z próbki A i xb z próbki B. Jak pokazano na rysunku 1B, każda izoforma ma 5. interwał o wartości 400 bp i zakładają, że każda pozycja ma pewien zasięg odczytu: (równanie 1), gdzie Rx, ia oznacza wektor odczytów w każdej pozycji w iformie dla genu x w próbce A. Znormalizowaliśmy każdy wektor z odpowiadającymi mu łącznymi odczytami: ( Równanie 2) gdzie a reprezentuje próbkę A; x oznacza dowolny gen x z genomu G; xa oznacza całkowitą liczbę odczytów dla genu x z próbki A; a NRDx, ia reprezentuje znormalizowaną głębokość odczytu dla próbki A dla izoformy genu x z genomu G. Następnie obliczono wektor znormalizowanego odczytu współczynnika głębokości odczytu (NRDR) z 400 elementów dla izoformy genu x z genomu G: (Równanie 3) gdzie n-ty element wektora NRDR definiuje się jako stosunek n-tego elementu NRDx, między innymi wektora do n-tego wektora wektora NRDx, ib. Po obliczeniu NRDR xi wyliczyliśmy wartości P na podstawie testu bayesowskiego (30). Otrzymaliśmy wektor wartości P z wektorów Rx, ia i Rx, ib oraz wartości xa i xb o tym samym rozmiarze jak NRDR xi: (Równanie 4), gdzie n-ty element wektora wartości P jest wartością P dla n-tego elementu wektor NRDR xi. Korzystając z NRDR xi i Pxi, przypisaliśmy wektor binarny do każdej izoformy genu x z genomu G: (równanie 5), gdzie j jest pozycją w 5. interwał (400 pz dla typowej izoformy, skorygowany do 200 pz, gdy inny gen potencjalnie pokrywa się z górnym regionem). Następnie obliczyliśmy wynik sx 5-RNA-Seq dla każdego genu x, który był sumą wektora binarnego dla x. W ten sposób uzyskaliśmy wektor punktowy dla wszystkich genów m dla genomu. tj. G [x] = {x1, x2, x3. . . xm}. dla próbek A i B: (Równanie 6) Zaimplementowaliśmy tę matematyczną koncepcję za pomocą Perl (Supplemental Software). Izolacja miocytów i nonyocytów. Komórki izolowano przy użyciu preparatu serca Langendorffa, jak wcześniej wykonano (17). Ponadto, ostateczny osad miocytów ponownie zawieszono w MEM z 5% FBS i 2 mM l-glutaminy i wysiano na powlekanych lamininą płytkach do hodowli (w inkubatorze z 2% CO2 w 37 ° C). Po godzinie inkubacji komórki przepłukano sterylnym PBS w celu usunięcia nieprzylegających komórek i szczątków, i dodano TRIzol (Invitrogen) w celu ekstrakcji całkowitego RNA zgodnie z protokołami producenta. 5. RACE. 5. RACE przeprowadzono przy użyciu dostępnego w handlu zestawu (Ambion, nr katalogowy AM1700), z amplifikacją przeprowadzoną przy użyciu polimerazy DNA rTth (Applied Biosystems, nr katalogowy N808-0188). W przypadku Fhl1 zastosowano zewnętrzny primer z sekwencją TCCAGATGTGATGGCCTTGTTGCACTT i wewnętrzny primer z sekwencją ACATGGTGCCCACCTTATAGCTGGA. Badanie Western blotting i histologia
[hasła pokrewne: jogurt naturalny przepis, rezonans magnetyczny otwarty warszawa, ostre zapalenie migdałków ]
[przypisy: zjazd ptd 2015, towarzystwo diabetologiczne, sympozjum diabetologiczne zakopane 2015 ]