5 RNA-Seq identyfikuje Fhl1 jako modyfikator genetyczny w kardiomiopatii ad 5

Badania ablacji genowej wyjaśniły tę niejednoznaczność: myszy pozbawione MHC403 / + / Fhl1 miały znacząco gorsze HCM, w tym zwiększony przerost LV, zwłóknienie i indukcję markerów molekularnych przebudowy patologicznej. Wynik ten był równoległy do stwierdzenia, że przerost wywołany izoproterenolem był cięższy u myszy bez Fhl2 (21), ale był niezgodny z obserwacją osłabionego przerostu przeciążenia ciśnieniowego u myszy WT z zerowym Fhl1 (18). Podejrzewamy, że różnice te odzwierciedlają niezależne hipertroficzne szlaki sygnałowe, które są wspierane przez wyraźną odpowiedź na inhibitor kalcyneuryny CsA, który zmniejsza przeciążenie ciśnieniowe przeciążenia u myszy WT (22), ale zwiększa przerost u myszy z mutacją genu sarcomere (23). Niedawno zaproponowano 3 rzadkie warianty ludzkie w FHL1, aby spowodować HCM (24), który wykazywał niekompletną penetrację u kobiet i związaną z nimi miopatię szkieletową u niektórych mężczyzn. Te myszy pozbawione Fhl mają normalne wymiary i funkcję serca, co prowadzi do alternatywnej interpretacji: że zmienność ludzka w Fhl1, w szczególności powodująca utratę funkcji białka, zapobiega zbawiennym skutkom zwiększonych poziomów i zmianie izoformy Fhl1 w HCM i innych chorobach serca. (i być może mięśnie szkieletowe). Chociaż mutacje wywołujące chorobę w HCM są autosomalnie dominujące, badania kliniczne wykazują bardziej poważny przerost (8) i dysfunkcję LV u mężczyzn (9, 10) w porównaniu z kobietami z HCM, a także więcej nagłych zgonów podczas uczestnictwa w sporcie (11). Samce i samice myszy MHC403 / + wykazują podobne różnice zależne od płci w nasileniu choroby (13). Delecja Fhl1 spowodowała głęboki przerost (zdefiniowany jako LVWT. 1,6 mm) u 43% kobiet i 25% męskich myszy pozbawionych MHC403 / + / Fhl1. Biorąc pod uwagę jego lokalizację na chromosomie X, spekulujemy, że dawkowanie genów i zmienność alleliczna FHL1 u ludzi przyczynia się do różnic płci w HCM. Na przykład projekt sekwencjonowania egzonów (25) zidentyfikował mutację FHL1 zmiany ramki i szkodliwą mutację missense (p.D275N) odpowiednio w 0,5% i 1,3% populacji. Ponieważ mężczyźni noszą pojedynczy allel FHL1, te i inne warianty utraty funkcji złagodziłyby potencjalne korzyści z ekspresji miocytów iFHL1 w odpowiedzi na stres. Podsumowując, nasza strategia 5. RNA-Seq dostarczyła nowy wgląd w różnorodność transkrypcyjną w genomie występującą w HCM. Dane 5. RNA-Seq ujawniły dynamiczną regulację iFhl1 w miocytach HCM, które po zniesieniu zwiększały procesy kardiomiopatyczne. Zgodnie z naszą wiedzą iFhl1 jest pierwszym korzystnym modyfikatorem genetycznym w HCM. Metody Modele organizmów. Myszy MHC403 / + w tle 129 / SvEv i myszy pozbawione Fhl1 na podłożu czarnego szwajcarskiego zostały pokryte, a badane były koty z różnych genotypów. Startery stosowane do genotypowania myszy pozbawionych Fhl1 były AAACCAGGCAAAGCGCCATTCG, GGCCCACTTGTCCTCTGAGTCAGC i TGCAAGGGGTCCCTGCAGTAGTGA. Kombinacja tych 3 starterów stosowanych w tej samej reakcji dała pasmo o masie cząsteczkowej około 370 pz (WT) lub około 5 510 pz (KO). W przypadku wszystkich myszy MHC403 / +, MHC403 / + / Fhl1-null i WT stosowanych w tych doświadczeniach, cyklosporynę A (CsA) podawano w pokarmie (100 mg CsA / 100 g karmy) w celu przyspieszenia przerostowej przebudowy (17). Badania echokardiograficzne. Myszy znieczulono parownikiem izofluranowym (VetEquip), a każdą kończynę umieszczono na przewodach EKG na stole do obsługi myszy Vevo (VisualSonics Inc.), utrzymując temperaturę ciała w 37 ° C podczas badania. Echokardiografię przezklatkową wykonano przy użyciu systemu mikroobrazowania Vevo 770 o wysokiej rozdzielczości in Vivo i głowicy skanującej RMV 707B (VisualSonics Inc.), z częstością akcji serca wynoszącą 500 550 550 uderzeń na minutę. Obrazy pozyskano jako 2D (lewa przymostkowa długa i krótka osie) i M-mode (lewa przymostkowa krótka oś). Pomiary zostały uśrednione z obrazów uzyskanych podczas 3 kolejnych uderzeń serca. Wszystkie pomiary echokardiograficzne przeprowadzono z użytkownikiem zaślepionym na genotyp myszy. Konstrukcja i analiza biblioteki 5. RNA-Seq. Próbki ludzkich tkanek uzyskano od uczestników badania poddawanych operacji miarektomii serca, operacji przeszczepu serca lub operacji wymiany zastawki. Wytworzono RNA z ludzkich tkanek i myszy LV (26). Aby zmniejszyć biologiczne zmiany w próbkach myszy, RNA połączono z co najmniej 3 biologicznych powtórzeń. Biblioteki 5. RNA-Seq skonstruowano tak jak opisano uprzednio, aby zapobiec fragmentacji RNA lub cDNA i nie obejmowały normalizacji (26). Jednolita amplifikacja biblioteki cDNA została uzyskana z cyklem amplifikacji, zanim reakcja osiągnęła nasycenie, co określono za pomocą ilościowej PCR. Po sekwencjonowaniu, dokonano wyrównania odczytów za pomocą Tophat (wersja 1.0.14) (27)
[przypisy: ile kalorii ma chleb żytni, poradnia laryngologiczna olsztyn, sympozjum diabetologiczne zakopane 2015 ]
[więcej w: ptd, polskie towarzystwo diabetologiczne, identyfikator uczestnika zjazdu ]